Animal infections
Mice have been bred and housed in particular pathogen-free amenities at The Francis Crick Institute. All protocols for breeding and experiments have been accepted by the Residence Workplace (UK) below mission license P4D8F6075 and carried out in accordance with the Animal Scientific Procedures Act, 1986.
Plasmids
All DNA constructs have been produced utilizing Escherichia coli DH5a (Thermo Fisher Scientific) and extracted utilizing a plasmid midiprep equipment from Qiagen. The plasmids used on this examine have been: RFP-GAL-350, LAMP1-RFP (Addgene, 1817) and G3BP1-mEGFP (Addgene, 135997).
Cells
iPS cell and iPSDM tradition
KOLF2 human induced pluripotent stem (iPS cells have been sourced from Public Well being England Tradition Collections (catalogue quantity 77650100). mEGFP-G3BP1 human iPS cells (used for CLEM research) have been sourced from Coriell Institute (catalogue quantity AICS-0082 cl.1). iPS cells have been maintained in Vitronectin XF (StemCell Applied sciences) coated plates with E8 medium (Thermo Fisher Scientific). Cells have been authenticated by STR profiling upon receipt and are checked month-to-month for Mycoplasma contamination by PCR. Cells have been passaged 1:6 as soon as at 70% confluency utilizing Versene (Gibco). Monocyte factories have been arrange following a beforehand reported protocol42. In short, a single-cell suspension of iPS cells was produced with TryplE (Gibco) at 37 °C for five min and resuspended in E8 plus 10 µM Y-27632 (Stem Cell Applied sciences) and seeded into AggreWell 800 plates (StemCell Applied sciences) with 4 × 106 cells per nicely and centrifuged at 100g for 3 min. The forming embryonic our bodies have been fed every day with two 50% medium modifications with E8 supplemented with 50 ng ml−1 human BMP4 (Peprotech), 50 ng ml−1 human VEGF (Peprotech) and 20 ng ml−1 human SCF (Peprotech) for 3 days. On day 4, the embryonic our bodies have been collected by flushing out of the nicely with mild pipetting and filtered by means of an inverted 40-µm cell strainer. Embryonic our bodies have been seeded at 100–150 embryonic our bodies per T175 or 250–300 per T225 flask in manufacturing facility medium consisting of X-VIVO15 (Lonza) supplemented with Glutamax (Gibco), 50 µM β-mercaptoethanol (Gibco), 100 ng ml−1 hM-CSF (Peprotech) and 25 ng ml−1 human IL-3 (Peprotech). These monocyte factories have been fed weekly with manufacturing facility medium for five weeks till plentiful monocytes have been noticed within the supernatant. As much as 50% of the supernatant was collected weekly and factories fed with 10–20 ml manufacturing facility medium. The supernatant was centrifuged at 300g for five min and cells resuspended in X-VIVO15 supplemented with Glutamax and 100 ng ml−1 human M-CSF and plated at 4 × 106 cells per 10-cm petri dish to distinguish over 7 days. On day 4, a 50% medium change was carried out. To detach cells, iPSDM plates have been washed as soon as with PBS then incubated with Versene for 15 min at 37 °C and 5% CO2 earlier than diluting 1:3 with PBS and gently scraping. Macrophages have been centrifuged at 300g and plated for experiments in X-VIVO15.
U2OS and HeLa cells
U2OS and HeLa cells have been cultured utilizing normal situations. Each cell traces have been maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). The cells have been incubated at 37 °C in a humidified environment containing 5% CO2. U2OS wild-type and G3BP1/2 KO U2OS cell traces have been from the laboratory of P. Anderson37. Cells have been unfavorable for mycoplasma contamination (checked by PCR).
iPSDM electroporation
Plasmid DNA was electroporated into iPSDM utilizing the Neon system (Invitrogen). iPSDM have been resuspended at 1.5 × 106 cells in 100 µl buffer R. Ten microlitres of cells per 1 µg plasmid DNA combine was aspirated right into a Neon pipette and electroporated in electroporation buffer E at 1,500 V for 30 ms with 1 pulse. Cells have been then plated in ViewPlate glass backside 96 nicely plates (6005430, PerkinElmer) for high-content evaluation or in IBIDI µ-Slide 18-well glass backside coverslips (81817) for confocal imaging research.
iPSDM nucleofection
iPSDM have been washed twice with PBS and electroporated within the acceptable major nucleofection resolution (AmaxaTM Human Monocyte Nucleofector Package, VPA-1007) utilizing the Lonza 2b Nucleofector (Nucleofector 2b Gadget, AAB-1001). 5 million iPSDMs have been used per response and resuspended in 100 µl of major nucleofection resolution containing 4 µg of Cas9 from Streptococcus pyogenes (SpCas9) (IDT) combined with a complete of 12 µg of focusing on artificial chemically modified single information RNA (sgRNA) (Synthego) (outlined beneath). iPSDMs have been then nucleofected with two sgRNAs focusing on the G3BP1 genes and two sgRNAs focusing on the gene G3BP2, and the Cas9–RNP combine utilizing the Y001 program. Nucleofected cells have been cultured in pre-warmed X-VIVO15 in a 35 mm Sterilin petri dish plate (121 V, Thermo Scientific). At 2 h submit nucleofection, 100 ng ml−1 human M-CSF was added to the cells. Dishes have been incubated in a humidified 37 °C incubator with 5% CO2. After 3 days, an equal quantity of contemporary full media together with 100 ng ml−1 human M-CSF was added. Six days after the preliminary isolation, differentiated macrophages have been indifferent in Versene and plated for experiments in X-VIVO15.
sgRNAs used have been: G3BP2_g1: CGCCCTACAAGCAGCGGACT; G3BP2_g2: AAGCTCCGGAATATTTACAC; G3BP1_g1: CGCCCGACCAGCAGGGGACT; and G3BP1_g2: AGGCCCCAGACATGCTGCAT.
siRNA transfection of HeLa cells
HeLa cells have been cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS. For brief interfering RNA (siRNA) transfection, SMARTpool siRNA focusing on G3BP1 and G3BP2 (obtained from Dharmacon) have been diluted in Opti-MEM medium, and DharmaFECT transfection reagent was combined with the siRNA to attain a remaining focus of 25 nM. The siRNA transfection complicated was incubated for five–10 min at room temperature. HeLa cells have been plated at a density permitting for 50–70% confluency on the time of transfection. The siRNA transfection complicated was then added to the cells plated in a 6 nicely plate (1.5 ml remaining quantity) and incubated for twenty-four h earlier than repeating the identical protocol for an additional day (two rounds of transfection). After 24 h, cells have been collected for subsequent experiments. As a management siRNA, a Silencer Choose Unfavourable Management No. 2 siRNA (4390846, Thermo Fischer) was used following the identical protocol.
The focusing on siRNAs have been as follows:
ON-TARGETplus SMARTpool siRNA J-012099-06, G3BP1 goal sequence GUGGUGGAGUUGCGCAUUA; ON-TARGETplus SMARTpool siRNA J-012099-07, G3BP1 goal sequence AGACAUAGCUCAGACAGUA; ON-TARGETplus SMARTpool siRNA J-012099-08, G3BP1 goal sequence GAAGGCGACCGACGAGAUA; ON-TARGETplus SMARTpool siRNA J-012099-09, G3BP1 goal sequence GCGAGAACAACGAAUAAAU; ON-TARGETplus SMARTpool siRNA J-015329-09, G3BP2 goal sequence UGAAUAAAGCUCCGGAAUA; ON-TARGETplus SMARTpool siRNA J-015329-10, G3BP2 goal sequence GAAUUUAAGUCUGGGACGA; ON-TARGETplus SMARTpool siRNA J-015329-11, G3BP2 goal sequence ACAACGACCUAGAGAACGA; ON-TARGETplus SMARTpool siRNA J-015329-12, G3BP2 goal sequence: GCGAUGGUCUUGACUAUUA.
Human monocyte-derived major macrophage isolation
White blood cells have been remoted from leukocyte cones (NC24) equipped by the UK Nationwide Well being Service blood and transplant service by centrifugation on Ficoll-Paque Premium (GE Healthcare 17-5442-03) for 60 min at 300g. Mononuclear cells have been washed twice with MACS rinsing resolution (Miltenyi 130-091- 222) to take away platelets, then remaining crimson blood cells have been lysed by incubation at room temperature with 10 mL RBC lysing buffer (Sigma R7757) per pellet for 10 min. Cells have been washed with rinsing buffer and pelleted as soon as extra, then resuspended in 80 µl MACS rinsing resolution supplemented with 1% BSA (MACS/BSA) and 20 µl anti-CD14 magnetic beads (Miltenyi 130-050-201) per 108 cells and incubated on ice for 20 min. Cells have been then washed in MACS/BSA by centrifugation, resuspended in 500 µl MACS/BSA per 108 cells and handed by means of an LS column (Miltenyi 130-042-401) within the area of a QuadroMACS separator magnet (Miltenyi 130-090-976). The column was washed thrice with MACS/BSA, then positively chosen cells have been eluted, centrifuged and resuspended in RPMI 1640 with GlutaMAX and HEPES (Gibco 72400- 02), 10% heat-inactivated FBS and 50 ng ml−1 hM-CSF (Preprotech) to a focus of 106 cells per ml in untreated petri dishes. These have been positioned in a humidified 37 °C incubator with 5% CO2, with an equal quantity of contemporary media together with human M-CSF added after 3 days. Six days after the preliminary isolation, differentiated macrophages have been indifferent in 0.5 mM EDTA in ice-cold PBS and 5 × 105 cells seeded per nicely of a 12-well plate for western blot experiments.
Mtb an infection of macrophages
Wild-type Mtb H37Rv and Mtb H37Rv ΔRD1 have been offered by D. Younger and S. H. Wilson. Fluorescent Mtb strains have been generated as beforehand reported51. E2-Crimson Mtb was generated by transformation with pTEC19 (Addgene 30178, deposited by L. Ramakrishnan). Strains have been verified by sequencing and examined for phthiocerol dimycocerosate positivity by skinny layer chromatography of lipid extracts from Mtb cultures. Mtb strains have been cultured in Middlebrook 7H9 supplemented with 0.2% glycerol, 0.05% Tween-80 and 10% albumin dextrose catalase (ADC). For macrophage infections, Mtb was grown to an optical density (OD600) ∼ 0.8 then centrifuged at 2,000g for five min. The pellet was washed twice with PBS, then the pellet was shaken with 2.5–3.5 mm glass beads for 1 min to provide a single-cell suspension. The micro organism have been resuspended in 10 ml cell tradition medium and centrifuged at 300g for five min to take away clumps. The OD600 was decided, and micro organism diluted to an acceptable OD for the required MOI—assuming OD600 = 1 equates to 108 micro organism per ml—earlier than including to cells in a minimal quantity. After 2 h, the inoculum was aspirated, cells washed twice with PBS and contemporary tradition medium added. Cells have been then incubated for acceptable time factors earlier than gathering for evaluation as described within the sections beneath.
LLOMe remedy
A 333 mM inventory of LLOMe (Cat# 4000725, Bachem) was ready in methanol and frozen at −20 °C in tightly sealed tubes. For LLOMe remedy, the medium was changed with X-VIVO15 (iPSDM), RPMI (HMDM) or DMEM (HeLa and U2OS cells) containing 1 mM of LLOMe until in any other case indicated within the determine legend. Methanol (0.3%) within the respective cell tradition media was utilized in all management situations.
Silica remedy
An answer of crystalline silica (MIN-U-SIL-15, US Silica) at 200 μg ml−1 was ready in X-VIVO15 and the cells have been stimulated for 3 h, after which they have been processed for downstream functions. In experiments with BAFA1 (Merck, B1793-10UG), iPSDM have been pre-incubated for 1 h with a 100 nM resolution. BAFA1 was saved within the medium throughout silica remedy.
Western blotting
For lysis, cells have been washed as soon as with PBS, and lysed on ice in RIPA buffer (Millipore) containing full, EDTA-free protease inhibitor (Roche). The samples have been boiled at 95–100 °C for five min in LDS pattern buffer and lowering agent (NuPAGE, Life Applied sciences) and run on a NuPAGE 4–12% Bis-Tris gel (Life Applied sciences). The gels have been transferred onto a PVDF membrane utilizing an iBlot 2 Dry Blotting System (Thermo Fischer), program P0. Membranes have been blocked in 5% skimmed milk powder in PBS plus 0.05% Tween-20 (PBS-T) for 1 h at room temperature then incubated with major antibody in a single day at 4 °C. Membranes have been washed in PBS-T and incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Membranes have been developed with enhanced chemiluminescence reagent (BioRad) and imaged on an Amersham Imager 680 instrument. Antibodies used: anti-G3BP1 (13057-2-AP) and anti-G3BP2 (16276-1-AP) from Proteintech, anti-p-eIF2α (Ser51) (9721), anti- eIF2α (9722) and anti-β-Actin (8H10D10, 12262) from Cell Signalling Expertise; and HRP-conjugated anti-mouse (W4021) and anti-rabbit (W4011) antibodies from Promega. All antibodies have been used at 1:1,000 dilution except HRP-conjugated antibodies that have been used at 1:10,000 dilution.
In vitro condensate–membrane experiments
Supplies
1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and 1,2-dioleoyl-sn-glycero-3-phospho-l-serine (DOPS) have been bought from Avanti Polar Lipids. The fluorescent lipid dye ATTO 647N-DOPE was acquired from ATTO-TEC. Polyvinyl alcohol (PVA, with MW 145000) and chloroform (HPLC grade, 99.8%) have been bought from Merck. Lipid shares have been combined as chloroform options at 4 mM, containing 0.1 mol% dye, and have been saved till use at −20 °C. Fluorescein isothiocyanate isomer (FITC), poly (A) RNA, 4-(2-hydroxyethyl)−1-piperazineethanesulfonic acid buffer (HEPES), sucrose, glucose, carbonate buffer tablets, hydrochloric acid (HCl), sodium hydroxide (NaOH), magnesium chloride (MgCl2), dimethyl sulfoxide (DMSO) and sodium chloride (NaCl) have been obtained from Sigma-Aldrich. All options have been ready utilizing ultrapure water from a SG water purification system (Ultrapure Integra UV plus, SG Wasseraufbereitung) with a resistivity of 18.2 MΩ cm.
Protein purification
Preparation of glycinin was achieved as described52. In short, defatted soy flour was dispersed in 15-fold water (weight) and pH was adjusted to 7.5 utilizing a 2 M NaOH resolution. Afterwards, the dispersion was centrifuged for 30 min at 9,000g at 4 °C. Dry sodium bisulfite (SBS) was added to the supernatant (0.98 g l−1 SBS), and the pH of the answer was adjusted to six.4 with an answer of two M HCl and saved at 4 °C in a single day. Then the dispersion was centrifuged throughout 30 min at 6,500g at 4 °C. The obtained glycinin-rich precipitate was dispersed in fivefold water and the pH was adjusted to 7.4. The glycinin resolution was then dialysed towards Millipore water for 2 days at 4 °C after which freeze-dried to amass the ultimate product with a purity of 97.5%. For glycinin labelling, a 20 mg ml−1 of protein resolution was ready in 0.1 M carbonate buffer (pH 9). A FITC resolution (4 mg ml−1 in DMSO) was slowly added into the protein resolution with mild stirring to a remaining focus of 0.2 mg ml−1. The pattern was incubated at midnight whereas stirring at 23 °C for 3 h. The surplus dye was eliminated utilizing a PD-10 Sephadex G-25 desalting column (GE Healthcare), and buffer was exchanged for ultrapure water. The pH of the labelled protein resolution was adjusted to 7.4 by including 0.1 M NaOH. For fluorescence microscopy experiments, an aliquot of this resolution was added to the working glycinin resolution to a remaining focus of 4%.
G3BP1 expression and purification have been tailored from Guillén-Boixet et al.10 with modifications. In short, recombinant His6–G3BP1–MBP and His6–GFP–G3BP1–MBP have been expressed in and purified from SF9 insect cells (Expression Programs, 94-001 F) utilizing a baculovirus expression system53. Following cell lysis (LM10, Microfluidics) in buffer A (50 mM HEPES/NaOH (pH 7.5), 1 M NaCl, 5% (w/v) glycerol, 2 mM EDTA, 2 mM DTT) supplemented with 1× EDTA-free protease inhibitor cocktail (Roche), the lysate was cleared by centrifugation at 50,000g for 50 min and subsequently the supernatant was utilized to a customized casted HiFlow amylose column (New England Biolabs). The column was washed with 10 column volumes buffer A, adopted by 10 column volumes buffer B (50 mM HEPES/NaOH, 100 mM NaCl, 5% gylcerol (w/v), 2 mM EDTA, 2 mM DTT, pH 7.5). 150 μl of 1 mg ml−1 His-tagged 3 C protease (home-made) in buffer B have been utilized for on-column tag elimination and incubated for 8 h at room temperature. The tag-free product was washed out with buffer B, utilized to a 5 ml HiTRAP Q HP column (Cytiva) equilibrated in buffer B and eluted with a linear gradient towards buffer A. Fractions containing the goal protein have been utilized to a HiLoad Superdex 200-pg 26/600 column (Cytiva) equilibrated in buffer C (50 mM HEPES/NaOH, 150 mM NaCl, 5% gylcerol (w/v), 2 mM EDTA, 2 mM DTT pH 7.5). G3BP1 fractions have been pooled, concentrated, flash frozen with liquid nitrogen and saved at −80 °C.
Vesicle preparation
DOPC and DOPC:DOPS 9:1 GUVs containing 0.1 mol % ATTO 647N-DOPE have been ready by the PVA gel-assisted methodology54 which permits protein encapsulation throughout vesicle swelling. In short, 2 coverslips have been cleaned with water and ethanol and dried with nitrogen. PVA resolution was ready by diluting PVA in deionized water at 60 °C to a remaining focus of 40 mg ml−1. A small aliquot (20–50 µl) of the PVA resolution was unfold on the glass slides and dried for 1 h at 60 °C. Lipid inventory resolution (3–4 μl) have been unfold on the PVA-coated glasses and saved for 1 h below vacuum at room temperature. The chamber was assembled utilizing the 2 coverslips and a 2-mm-thick Teflon spacer, and crammed as follows in line with the completely different experiments:
For G3BP1 encapsulation in GUVs, the swelling buffer consisted in 10 µM GFP–G3BP1 in 50 mM HEPES pH 7.5, 100 mM NaCl, 4 mM MgCl2.
For glycinin encapsulation, the swelling resolution contained 10 mg ml−1 glycinin in 15 mM NaCl, 10 mM sucrose at pH 7.4 for the pH-triggered section separation experiments. For inducing salt-driven section separation the answer consisted of 300 mM sucrose at pH 7.4.
In all instances pH was adjusted utilizing a 2 M NaOH resolution. After 30 min, the chamber was opened, and the vesicles have been collected fastidiously to forestall PVA detaching from the quilt glasses. Osmolarities have been measured and adjusted utilizing a freezing level osmometer (Gonotec Osmomat 3000).
Encapsulation of the proteins was most popular over having the proteins within the exterior resolution on account of a number of experimental constraints. First, protein focus is a limiting issue and having the protein contained in the vesicles requires a lot much less protein than having it within the exterior resolution, which within the microfluidic experiments is below a relentless movement. Second, if the proteins have been within the exterior resolution, the labelled proteins would make the entire area of view fluorescent, which might hinder visualization of the experiment and high-precision imaging. Lastly, it’s preferable to have the decrease pH on the surface, as a result of GUV formation results in greater yield and higher high quality at impartial somewhat than acidic pH. It is very important observe that the outcomes are impartial of the experimental selection for resolution location (inside versus outdoors), since condensate formation is pushed by the exterior and inside options mixing on the pore (as proven in Fig. 2 and Prolonged Information Fig. 4), and the end result is not going to depend upon the positional order of the options throughout the membrane. Moreover, due to the massive measurement of the GUVs, the membrane is sort of flat with negligible curvature (decrease than 0.1 μm−1) and never anticipated to have a job.
Microfluidics and resolution change
The microfluidic machine consists of a cascade GUV trapping system, which is described intimately elsewhere55. It was produced utilizing poly(dimethylsiloxane) (PDMS) pre-cursor and curing agent (Sylgard 184, Dow Corning GmbH), at a mass ratio of 10:1. After polymerization at 80 °C for 3 h, inlet and outlet holes have been punched with a biopsy punch with a plunger system (Kai Medical). Then the PDMS chips and glass coverslips have been handled with plasma for 1 min utilizing high-power expanded plasma cleaner (Harrick Plasma), after which bonded collectively. Earlier than the experiments, the specified quantity of resolution was crammed into the microfluidic machine by centrifugation at 900 relative centrifugal power (Rotina 420 R, Hettich). Answer change was carried out with a NeMESYS high-precision syringe pump. The movement pace for the preliminary washout of the remaining labelled protein within the exterior (Prolonged Information Fig. 4f,g) was set to 1 μl min−1 for 40 min to make sure a minimum of 10 instances change of the inner quantity of the microfluidic machine (~4 µl). To alter the pH and introduce the hypotonic options, the next pace of two μl min−1 was used to make sure fast change, to keep away from section separation on account of passive proton permeation56,57,58. At this excessive movement, vesicles have been pushed towards the posts of the microfluidic machine and small deformations may very well be noticed (Fig. 2a). After full resolution change, the movement pace was lowered to 0.035 μl min−1 to forestall vesicle motion and facilitate imaging.
The hypotonic buffer consisted in 20 mM HEPES, 100 mM NaCl, 4 mM MgCl2, pH 5 for G3BP1 experiments. For glycinin pH-driven section separation the exterior hypotonic resolution was deionized water at pH 4.8, with the pH adjusted utilizing an answer of two M HCl. For the experiments with section separation triggered by NaCl, the hypotonic buffer consisted of a 100 mM NaCl resolution, pH 7.4.
In vitro G3BP1–RNA granules formation
G3BP1–poly(A)-RNA condensates have been reconstructed following Guillén-Boixet et al.10. To type the condensates, 20 µl of an answer containing a remaining focus of 5 µM GFP–G3BP1 and 200 ng µl−1 of poly(A)-RNA in 50 mM HEPES, 100 mM NaCl, 4 mM MgCl2 was straight positioned on a glass slide and instantly visualized by confocal microscopy.
Molecular dynamics
To simulate poration and plugging of lipid vesicles, we think about a minimal coarse-grained molecular dynamics system the place the answer of proteins out and in of the vesicle is described by beads dispersed in implicit solvent. The membrane is described as a one-bead-thick fluid elastic layer of mechanical properties that mimic organic membranes. We tune the interactions between resolution beads within the completely different compartments to seize the variations between the cytoplasmic and endosomal protein options and discover how the system responds to completely different levels of membrane poration. Particulars on how the molecular dynamics was carried out are within the Supplementary Information and Supplementary Desk 1.
Molecular dynamics evaluation
To characterize and perceive the plugging impact of protein condensates on broken vesicles we are able to observe how the vesicle floor evolves and the way the particles that are initially in every compartment (inside or outdoors) combine all through the course of the simulation.
To take action, a primary important step is reconstructing the membrane floor from the mannequin particle positions and orientations, for which we use customized Python code59 based mostly on the ball pivot algorithm60. Our evaluation gives an estimate for the vesicle floor space and native boundaries and orientations along with a group of pores and their perimeter, which permits us to guage pore closure.
As soon as we’ve got outlined the vesicle floor, we consider condensation by working a clustering algorithm on the solute and protein particles (a part of the Ovito library in Python61). This permits us to differentiate between condensate particles and resolution particles and to calculate droplet properties (corresponding to mass or radius of gyration) in addition to the full droplet progress charge over time. As soon as we’ve got recognized the particles that stay in resolution, we are able to then decide which compartment they belong to (contained in the vesicle or outdoors) and by evaluating with the preliminary situations we are able to decide resolution change fluxes.
To categorise the particles as inside lumen or outer lumen we decide every particle’s closest six floor triangles (utilizing a neighbour record algorithm from the Freud library for Python62) and compute the unit vector alongside the road connecting the particle and every of its neighbour triangles centres. We then compute the dot merchandise ρ of those unit vectors with the native regular of the floor (beforehand recognized utilizing the ball pivot algorithm). Lastly, if the common dot product ⟨ρ⟩ > 0.5 we classify the particle as being contained in the vesicle. Conversely, if ⟨ρ⟩ < −0.5 we classify the particle as being outdoors the vesicle. On this evaluation, particles which can be near the pore current dot merchandise near zero (|⟨ρ⟩| < 0.5), and on this case we evaluate their place to the pore’s centre of mass to find out their compartment.
As soon as we’ve got a listing of inside particles, outer particles and droplet particles, we are able to outline fluxes by evaluating these values throughout the simulation and characterize the blending of options and the condensate progress in numerous situations.
Imaging
Stress granules and GAL-3 staining
After the indicated remedy, cells have been washed as soon as with PBS and glued with 4% methanol-free paraformaldehyde (PFA) in PBS for 15 min. After 3 washes with PBS, cells have been permeabilized utilizing a 0.5% Triton X-100 (Sigma)/PBS resolution for 10 min. Cells have been then immunostained utilizing the corresponding antibodies. Antibodies have been: anti-G3BP1 (13057-2-AP) or alternatively, anti-G3BP1 (66486-1-Ig, sc-365338 AF546), anti-G3BP2 (16276-1-AP) anti-TIA1 (12133-2-AP), anti-PABPC1 (10970-1-AP), anti-ALIX (12422-1-AP), anti-CHMP2a (10477-1-AP), anti-CHMP4b (13683-1-AP), anti-annexin A1 (66344-1-Ig), anti-annexin A2 (66035-1-Ig), anti-EIF3B (10319-1-AP), and anti-EIF4G1 (15704-1-AP) from Proteintech. Anti-GAL-3 (125410) and anti-LAMP-1 (121610) from Biolegend. Anti-p62 (GTX111393) from GeneTex, anti-phospho TBK1 (5483 T) from Cell Signalling Applied sciences. Anti-PI4K2a (B-5, sc390026) and anti-ORP9 (A-7, sc398961) from Santa Cruz. Antibodies have been used at 1:200 dilution. Pictures have been acquired on Ibidi glass backside slides (81817) utilizing a Leica SP8 confocal microscope (for Mtb fastened imaging and silica crystals experiments) or utilizing a VT-iSIM superresolution imaging system (Visitech Worldwide). Nuclear staining was carried out utilizing 300 nM DAPI (Life Applied sciences, D3571) in PBS for five min. The realm of GAL-3 and stress puncta per cell was evaluated utilizing the picture evaluation software program FIJI/ImageJ as described beneath.
Fluorescence restoration after photobleaching
Fluorescence restoration after photobleaching (FRAP) experiments have been carried out utilizing a Zeiss Invert880 microscope system (Zeiss) and the bleaching module of Zeiss ZEN software program. Photobleaching of G3BP1–mEGFP was achieved utilizing a 488-nm laser at a scan pace = 1 (pixel dwell 131.07 ms). Pictures have been captured at 20 or 30-s intervals for a minimum of 20 min. The photobleaching began after three time factors that have been used because the basal depth reference.
Confocal microscopy of GUVs
Confocal Leica SP8 microscope geared up with a 63×, 1.2 NA water-immersion goal and a 40× 1.3 NA oil immersion goal (Leica) was used for imaging. FITC and ATTO 647N-DOPE have been excited utilizing the 488 nm and 633 nm laser traces, respectively and sign was collected between 500–600 nm for FITC and 650–720 nm for ATTO. Time-lapse sequences (xyt) of particular person GUVs have been acquired at 650 ms per body utilizing the bidirectional acquisition mode.
Excessive-content live-cell imaging
Thirty thousand iPSDM have been seeded right into a ViewPlate glass backside 96 nicely plate (PerkinElmer) and handled with LLOMe or contaminated with Mtb as described above. The plate was sealed with parafilm and positioned in a pre-heated (37 °C) Opera Phenix microscope with a 40× or 60× water-immersion lens (PerkinElmer) with 5% CO2. Seize settings have been: LysoTracker Crimson was excited with the 561 nm laser at 10% energy with 100 ms publicity. MitoTracker Deep Crimson FM (M22426, Thermo Fischer), iABP probe and Mtb E2-Crimson have been excited with the 640 nm laser at 10% energy with 100 ms publicity. DAPI was excited with the 405 nm laser at 20% energy with 100 ms publicity. At the very least 20 fields per nicely have been imaged in all of the experiments. Pictures have been acquired at 1,020 × 1,020 pixels utilizing Concord 4.9 high-content imaging and evaluation software program (PerkinElmer).
Superresolution live-cell imaging
iPSDMs transfected with GAL-3–RFP, G3BP1–mEGFP or LAMP1–RFP have been handled with LLOMe (1 mM) and imaged on a VT-iSIM superresolution imaging system (Visitech Worldwide), utilizing an Olympus IX83 microscope, 150×/1.45 Apochromat goal (UAPON150XOTIRF), ASI motorized stage with piezo Z, and a pair of× Prime BSI Specific scientific CMOS cameras (Teledyne Photometrics). Cells have been at all times within the stage incubator at 37 °C and 5% CO2. Simultaneous GFP and mCherry imaging was completed utilizing 488 nm and 560 nm laser excitation and ET525/50 m and ET600/50 m emission filters (Chroma), respectively. Z-stacks (100 nm z-step) have been acquired on the intervals indicated within the determine legends. The microscope was managed with CellSens software program (Olympus). Picture processing and deconvolution was completed utilizing Huygens Important software program (Scientific Quantity Imaging). For 3D imaging, spatial deconvolution and 3D surface-rendering reconstruction, z-stack slices have been outlined every 200 nm (if confocal microscope was used) or 100 nm (if VT-iSIM microscope was used) and pictures have been processed utilizing Huygens Important Software program (Scientific Quantity Imaging).
LysoTracker restoration assay
Forty thousand cells (background indicated within the determine legends) have been seeded right into a ViewPlate glass backside 96 nicely plate (PerkinElmer). Cells have been loaded with the nuclear dye Nuclear Inexperienced LCS1 (Abcam) at a dilution of 1:5,000 and 25 nM LysoTracker DND-99 (Thermo Fisher Scientific) for 20 min. The cells have been washed twice in X-VIVO15, and the medium was changed with X-VIVO15 containing 25 nM LysoTracker. The cells have been imaged each 1 min at 37 °C, 5% CO2 utilizing an Opera Phenix microscope (PerkinElmer). First, a baseline was established by imaging 3 time factors, adopted by the addition of LLOMe to a remaining focus of 1 mM. After 2 time factors, the cells have been washed 3 instances with X-VIVO15 and the medium was changed with X-VIVO15 containing 25 nM LysoTracker, and lysosomal restoration was adopted for 20 min. Evaluation was completed as indicated beneath (see ‘Imaging evaluation’).
10K-dextran launch assay
Wild-type and G3BP-DKO U2OS cells have been seeded right into a PerkinElmer Cell Service Extremely 96 nicely plate (PerkinElmer) and incubated with 25 µg ml−1 10K-dextran conjugated to Alexa Fluor 647 (D22914; Thermo Fisher Scientific) in DMEM for 12–16 h, after which in contemporary DMEM for two–4 h (chase) to permit dextran to succeed in the lysosomes3. After that, cells have been handled with LLOMe (2 mM, 2 min), cells have been then washed inside a min and imaged for 40 min after in contemporary medium. Pictures have been acquired at 1 min intervals.
Immunofluorescence of lung sections
Tissue sections (see ‘Tissue sectioning’) on SuperFrost Plus Adhesion slides (Fisher Scientific, 11950657) have been unfrozen at room temperature and and permeabilized with a 0.5% resolution of Tween-20/PBS for 20 min. After that, samples have been washed twice with PBS and stained with the corresponding major antibodies (dilution 1:100) for two h. The coverslips have been then washed twice with PBS and incubated with the corresponding Alexa Fluor (Thermo Fischer) secondary antibodies (dilution 1:700) for 1 h. After two washes with PBS, the samples have been mounted utilizing Dako fluorescence mounting medium (S3023).
Poly(A) RNA in situ protocol
iPSDM cultured in µ-Slide 18-Nicely Glass Backside plates (Ibidi) have been fastened in 4% PFA for 10 min, PFA aspirated, and 100% chilly methanol added to every nicely for 10 min. Methanol was changed with 70% ethanol and incubated for 10 min. The ethanol was aspirated and 1 M Tris, pH 8.0 added to every nicely for five min. After Tris elimination, hybridization buffer was added containing the dilution of 5′-labelled Cy3-Oligo-dT(20) inventory (Built-in DNA Applied sciences) for a remaining focus of 1 ng μl−1. Hybridization was carried out at 37 °C for two h. After hybridization, samples have been washed as soon as with 4× SSC after which as soon as with 2× SSC (all DEPC-treated). Incubation with major antibodies was in 2× SSC + 0.1% Triton X-100 for two h, washed thrice with 2× SSC, after which incubated with secondary antibodies for 1 h at room temperature. Hybridization buffer composition: 1 mg ml−1 Yeast tRNA (AM7119 Thermo Fischer), 0.005% BSA, 10% dextran sulfate (D8906-5G, Merck), 25% Formamide (17899, Thermo Fischer) 20× SSC + DEPC water in order that remaining buffer quantity is in 2× SSC.
Electron microscopy
Fixation
Samples have been fastened by including a mix of 8% PFA in 200 mM HEPES buffer to tradition medium (v/v) and incubated at room temperature for 15 min then changed with 4% PFA in 100 mM HEPES for 30 min earlier than imaging by confocal microscope. After imaging by confocal, samples have been transferred to 1% glutaraldehyde in 100 mM HEPES buffer.
Resin embedding
Fluorescently imaged samples have been processed for correlative gentle and electron microscopy in a Biowave Professional (Pelco) with use of microwave power and vacuum. Cells have been twice washed in HEPES (Sigma-Aldrich H0887) at 250 W for 40 s, post-fixed utilizing a mix of two% osmium tetroxide (Taab O011) 1.5% potassium ferricyanide (Taab, P018) (v/v) at equal ratio for 14 min at 100 W energy (with/with out vacuum 20 inch Hg at 2-min intervals). Samples have been washed with distilled water twice on the bench and twice once more within the Biowave 250 W for 40 s. Samples have been stained with 1 % aqueous uranyl acetate (Agar scientific AGR1260A) in distilled water (w/v) for 14 min at 100 W energy (with/with out vacuum 20 inch Hg at 2-min intervals) then washed utilizing the identical settings as earlier than. Samples have been dehydrated utilizing a step-wise acetone sequence of fifty, 75, 90 and 100%, then washed 4 instances in absolute acetone at 250 W for 40 s per step. Samples have been infiltrated with a dilution sequence of 25, 50, 75, 100% Durcupan ACM (Sigma-Aldrich 44610) (v/v) resin to propylene oxide. Every step was for 3 min at 250 W energy (with or with out vacuum 20 inch Hg at 30 s intervals). Samples have been then cured for no less than 48 h at 60 °C.
Pattern trimming and picture acquisition
Referring to grid coordinates, the pattern block was trimmed, coarsely by a razor blade then finely trimmed utilizing a 35° ultrasonic, oscillating diamond knife (DiATOME, Switzerland) set at a chopping pace of 0.6 mm s−1, a frequency set by computerized mode and a voltage of 6.0 V, on a ultramicrotome EM UC7 (Leica Microsystems, Germany) to take away all extra resin surrounding the area of curiosity (ROI). Ribbons have been lower to a thickness of 65 nm and Pictures have been acquired utilizing a JEOL JEM-1400 sequence 120 kV transmission electron microscope.
Correlative gentle and electron microscopy picture alignment
Fluorescent photographs have been transformed to tiff file format and liner changes made to brightness and distinction utilizing FIJI (model 2.9.0/1.53t). Fluorescent photographs have been aligned to serialEM micrographs (TrakEM2) utilizing BigWarp_fiji_7.0.7 plugin. At least 10 impartial fiducials have been chosen per alignment for 3D picture registration. When the fiducial registration error was larger than the anticipated registration error, a non-rigid transformation (a nonlinear transformation based mostly on spline interpolation, after an preliminary inflexible transformation) was utilized.
Imaging evaluation
Stay-cell imaging evaluation of G3BP1+ and GAL-3+ occasions
An occasion was thought of constructive when the fluorescence sign was a minimum of thrice larger than the imply background (decided beforehand to the addition of LLOMe). Intensities have been quantified choosing the corresponding ROI in FIJI/ImageJ. G3BP1+ and GAL-3+ occasions have been manually tracked over time and the time registered when the primary constructive occasion was detected. At the very least 20 occasions per experiment have been annotated. The proportion of ‘capping occasions’ was decided contemplating the quantity of double-positive G3BP1+/GAL-3+ occasions that introduced a polarized G3BP1 fluorescence sign distribution compared with the distribution noticed for GAL-3+ vesicles. To this finish, GAL-3+ areas have been segmented and the imply depth of G3BP1 in these areas decided. A G3BP1+ occasion was thought of polarized (in ‘cap sample’) when the G3BP1 imply depth, of a ROI in proximity of a GAL-3+ occasion, was a minimum of two instances larger than the G3BP1 imply depth equivalent to the segmented (overlapping) GAL-3+ space. For fluorescence depth or puncta space over time evaluation, the corresponding values after segmentation have been plotted utilizing the geom_smooth perform in R Studio (methodology = “loess”) (see supply information for Fig. 1).
Spatial level sample evaluation
To find out whether or not the distances between factors in group A (G3BP1+) and factors in group B (GAL-3+) have been considerably completely different from the distances between factors in group A and randomly generated factors, we carried out a spatial level sample evaluation utilizing the spatstat package deal in R (model 3.0–6). First, some extent sample object was created from the x and y coordinates of the information utilizing the ppp perform. The lambda worth, which represents the depth of the purpose sample for group A, was then calculated because the variety of factors in group A divided by the world of the purpose sample. Subsequent, a random level sample with the identical window as the unique level sample was generated utilizing the runifpoint perform. The distances between factors in group A and factors in group B have been then calculated utilizing the nncross perform, and the distances between factors in group A and the randomly generated factors have been calculated in an analogous means. The variety of simulated distances that have been lower than or equal to the noticed distances was counted and used to calculate a P worth utilizing a Monte Carlo simulation. A complete of 1,000 simulations have been carried out to estimate the P worth. Lastly, a boxplot was created to visually evaluate the distribution of noticed distances between factors in group A and factors in group B to the distribution of distances between factors in group A and randomly generated factors.
Stress granules and GAL-3 puncta evaluation
Evaluation was completed in Fiji/ImageJ utilizing the sequence Picture>Alter>Threshold after which puncta or space within the segmented picture was decided utilizing the menu command Analyze>Analyze particles. Measurement was restricted to particles larger than 0.1 um and the circularity restricted to values between 0.4 and 1.
Co-localization evaluation
VT-iSIM photographs have been analysed utilizing the EzColocalization plugin63 on FIJI/ImageJ and Spearman’s rank correlation coefficient (SRCC) values used for quantification. Evaluation was completed on a single z-stack part of 150 nm.
Excessive-content imaging and analysis of lysosomal exercise and content material
iPSDM have been incubated with 1 µM resolution of the iABP Good Cathepsin Imaging Probe (40200-100, Vergent Bioscience) for 3 h at 37 °C and 5% CO2. Cells have been single-cell segmented based mostly on nuclear staining and lysosomes segmented utilizing the Discover Spots and Morphology Properties modules of Concord 4.9 software program. After that lysosomal depth values (650–760 em) and mobile morphology parameters have been quantified.
LysoTracker restoration evaluation
iPSDM have been segmented utilizing the NucGreen nuclear sign and Discover Nuclei module or based mostly on mobile segmentation after making use of the Inverse Gray palette and Discover Cell module of Concord 4.9 software program. LysoTracker puncta have been recognized utilizing the Spots constructing block (native most). The spot depth per cell and timepoint was normalized to the common of relative spot depth earlier than LLOMe addition. For every experiment, a minimum of 300 cells have been analysed per situation.
Mtb replication evaluation
Pictures of Mtb-infected iPSDM have been acquired on an Opera Phenix microscope utilizing a 40× goal with a minimum of 20 fields of view per nicely (with three wells per situation) and analyzed in Concord 4.9. Cells have been segmented based mostly on DAPI, excluding any cells touching the sting of the imaged space. Micro organism have been detected utilizing the Discover Spots constructing block of Concord. The entire bacterial space in every cell was then decided. Information was exported and analysed in R Studio to calculate the imply Mtb space per cell for every situation at every timepoint, with all three wells pooled. At the very least three impartial experiments have been completed per situation and timepoint.
Mouse aerosol an infection with Mtb H37Rv
Six- to eight-week-old, feminine C3HeB/FeJ mice have been contaminated with both wild-type Mtb Wasabi HygR or Mtb ΔRD1 E2-Crimson KanR. Pattern measurement was decided in accordance with ARRIVE tips and former research64. 5 animals per group have been used per time of an infection. Females have been used for security and house allocation restrictions as contaminated mice have been contained in BSL3. All mice have been maintained in BSL3 cages, at 22 ± 2 °C and a relative humidity of 55 ± 10%. No randomization or blinding was utilized for this examine. For low dose aerosol an infection experiments all micro organism have been used at mid-exponential section and a Glascol aerosol generator was calibrated to ship roughly 100 colony-forming items (CFU) of wild-type Mtb Wasabi HygR/lung and 500 CFU of Mtb ΔRD1 E2-Crimson KanR/lung. Fifty-six days after an infection, lungs have been perfused in 4% PFA for fluorescence microscopy evaluation. Lungs have been equilibrated in 0.1 M HEPEs buffer (pH 7.4) with 0.2 M sucrose for 1 h earlier than being transferred to silicon moulds containing OCT medium (Agar scientific, AGR1180). Moulds containing OCT and lungs have been then transferred to dry ice and frozen in preparation for sectioning. Sections have been lower utilizing a Leica CM30505S Cryostat (CT-18 °C, OT-20 °C), to a measurement of 8 μm. Sections have been collected on SuperFrost Plus Adhesion slides (Fisher Scientific, 11950657) and saved at −80 °C earlier than additional processing.
Statistical evaluation
Statistical evaluation was carried out utilizing GraphPad Prism 10 software program or R Studio 2023.03.0 (R model 4.2.2). Excessive-content imaging evaluation and imply values have been obtained utilizing R 4.2.2 or Concord 4.9 software program. The variety of organic replicates, the statistical evaluation carried out, and submit hoc checks used are talked about within the determine legends. The statistical significance of information is denoted on graphs by informing the P worth or asterisks, the place *P < 0.05, **P < 0.01, ***P < 0.001; or NS, not important. Graphs have been plotted in GraphPad Prism software program or utilizing R Studio 2023.03.0 (R model 4.2.2). RNA-sequencing information have been obtained from a earlier examine42 and plotted utilizing Morpheus (https://software.broadinstitute.org/morpheus/). Schematics have been created with BioRender.com.
Ethics
This examine concerned the usage of KOLF2 human iPS cells, Public Well being England Tradition Collections, catalogue quantity 77650100, and the usage of WTC human mEGFP-tagged G3BP1 iPS cells (Coriell Institute, AICS-0082 cl.1). Using human cells is roofed and accepted by the Moral Committee and controlled by the Francis Crick Institute Organic Security Code of Apply within the mission registered on the Crick (Undertaking HTA17) framed below Human Tissue Authority Licence quantity 12650.
Reporting abstract
Additional info on analysis design is out there within the Nature Portfolio Reporting Summary linked to this text.
